Category: Python

built-in function to check the length of a string.

Write a function called palindrome that takes a string argument and returns True if it is a palindrome and False otherwise. Remember that you can use the built-in function len( ) to check the length of a string. answer: Here’s a Python function called `is_palindrome` that checks if a string is a palindrome: “`python def […]

Read More

Python Question

>Write a function called gcd that takes parameters a and b and returns their greatest common divisordivisor Answer: You can implement the greatest common divisor (GCD) function using the Euclidean algorithm. Here’s how you can do it in Python: “`python def gcd(a, b): while b: a, b = b, a % b return a # […]

Read More

convert a list and tuple into arrays.

You can use Python’s NumPy library to convert a list and tuple into arrays. Here’s a simple program to demonstrate this: “`python import numpy as np def convert_to_array(input_data): if isinstance(input_data, list): return np.array(input_data) elif isinstance(input_data, tuple): return np.array(input_data) else: raise ValueError(“Input data must be either a list or a tuple”) # Example usage: input_list = […]

Read More

convert a list and tuple into arrays.

Certainly! Lets create Python programs to convert lists and tuples into NumPy arrays. NumPy is a powerful library for numerical computations, and it provides convenient methods for array manipulation. Convert a List to a NumPy Array You can use either numpy.array() or numpy.asarray() to convert a Python list into a NumPy array. Here are examples […]

Read More

convert a list and tuple into arrays.

Certainly! Lets create Python programs to convert lists and tuples into NumPy arrays. NumPy is a powerful library for numerical computations, and it provides convenient methods for array manipulation. Convert a List to a NumPy Array You can use either numpy.array() or numpy.asarray() to convert a Python list into a NumPy array. Here are examples […]

Read More

print all prime numbers in a given interval

upper = 1000 print(“Prime numbers between”, lower, “and”, upper, “are:”) for num in range(lower, upper + 1): # all prime numbers are greater than 1 if num > 1: for i in range(2, num): if (num % i) == 0: break else: print(num) Output: Theoutput of this program will be the prime numbers between 900 […]

Read More

Kindly bid this question if your sure you can handle, will add 100$ tip

Provide code and the expected output 1. Street Gaussians for Modeling Dynamic Urban Scenes 2.Title: Word-As-Image for Semantic Topography 3. 3D Gaussian Splatting for Real-time Radiance Field Rendering 4. Segmenting 3D Scenes with SAM check out this links done https://wordasimage.github.io/Word-As-Image-Page/ done https://github.com/graphdeco-inria/gaussian-splatt… done https://github.com/Pointcept/SegmentAnything3D

Read More

Python Question

The initial project consisted of developing a machine learning model in Python for a specific application or problem domain. The project requires to demonstrate the understanding of data preprocessing, model selection, evaluation metrics, and effective communication of results. This step of creating the machine learning model in Python is already finished and I will provide […]

Read More

I’m working on a python question and need a sample draft to help me learn. Explanation is long but simple

Example: Suppose that your program receives the … Patient Sample 11223344 GGTCGGTAGACAGGTCGGTAGACAGGTCGGTAGACA 22233344 TTTCAGAATTAGACTGTTTAGAGAAACTAGACCACA 33344455 CCTAGTATGCACTATTGAAATGCTCGTTGATAGACA 55667788 TGCTCGTTAGTGAACACTTAGACTGTTTAGGACCAC You know from a that these DNA sequences convert to… Glycine,Arginine,.,Threonine,Glycine,Arginine,.,Threonine,Glycine,Arginine,.,Threonine Phenylalanine,Glutamine,Asparagine,.,Threonine,Valine,.,Arginine,Asparagine,.,Threonine,Threonine Proline,Serine,Methionine,Histidine,Tyrosine,.,Asparagine,Alanine,Arginine,.,.,Threonine Cysteine,Serine,Leucine,Valine,Asparagine,Threonine,.,Threonine,Valine,.,Aspartic acid,Histidine These are amino acid sequences, and your program’s job is to let the user search for patients whose amino acid sequences contain […]

Read More